p53 response elements

Here is a non-exhaustive list of known p53 responsive-elements.

p53-RE name Gene/Protein activity Tetrameric p53-RE sequence (5’→3’)(a)(b) p53-RE location PubMed
    RRRCWWGYYY (N) RRRCWWGYYY
R=A or G; W =A or T; Y = C or T;
N= 0 to 13 nt
   
p53CON   GGGCATGTCC GGGCATGTCC   12909720
    GGGCTAGTCC GGGCTAGTCC   12909720
    GGGCAAGTCT GGGCAAGTCT   12909720
    GGACATGCCC GGGCATGTCC   1588974
 PG13   13 copies of p53CON   1588974
14-3-3s Cell cycle arrest AGGCATGTgC cAcCATGCCC ­ 2,5 kb 9659898
    GtAGCAttAGCCC AGACATGTCC ­ 1,8 kb 9659898
AIP1 Apoptosis tctCTTGCCC GGGCTTGTCg intron 1 11030628
BAX Apoptosis tcACAAGTTaGAGACAAGCCT -113 to -93 10559267
    AGACAAGCCT GGGCgTGggC -102 to -83 10559267
    AGACAAGCCTGGGCGTGGGCTAtaTT -102 to -77 10559267
BTG2 Cell cycle arrest AGtCcgGgCAGAGcCcgagCa -122 to -74 11814693
CD95-Fas Apoptosis GGACAAGCCC tGACAAGCCa intron 1 9841917
C-FOS Component of
AP-1
GGACTTGTCT GAGCgcGTgC AcACTTGTCa tAGtAAGaCT intron 1 10082525
CSR Oxydative stress GGGCAAGCCC AGACAAGTTg intron 2 9580669
CyclinG Cell cycle progression GcACAAGCCC AGGCTAGTCC intron 1 8954786
GADD45 Cell cycle arrest GAACATGTCT AAGCATGCTg intron 3 8226988
GML Unknown AtGCTTGCCC AGGCATGTCC AGGCATGTCC AGGCTgGTCC -19 kb 8934543 9169150
EGFR Cell proliferation GAGCTAGaCgTCCGGGCAgcCCC -265 to
-239
8887630
IGF-BP3-boxA Apoptosis AAACAAGCCaCcAACATGCTT intron 1 7566179
IGF-BP3-boxB   GGGCAAGaCC tGcCAAGCCT intron 2 7566179
KILLER/DR5 Apoptosis GGGCATGTCC GGGCAAGaCg intron 1 10777207
MDM2 p53 regulation GGtCAAGTTC AGACAcGTCC intron 1 7651818
    AGttAAGTCC tGACTTGTCT intron 1 7651818
MSH2 DNA repair AGGCTAGTTT(13bp)AAGtTTcCTT -447 to
-414
10984493
NOXA Apoptosis AGGCTTGCCC cGGCAAGTTg -174 to
-155
10807576
P53DINP1 Regulation of p53-dependent apoptosis GAACTTGggg GAACATGTTT intron 2 11511362
P53R2 DNA repair tGACATGCCC AGGCATGTCT intron 1 10716435
P53RFP p21WAF1 regulation AGACAgGTCC tGACAAGCag -157 to
-137
12853982
PA26 Oxydative metabolism GGACAAGTCT ccACAAGTTC intron 2 9926927
PCNA DNA repair / Replication GAACAAGTCC GGGCATaTgT -236 to
-217
8570655
PIDD Apoptosis AGGCcTGCCTGCGTGCTGGGACATGTCT -54 to -26 10973264
PIG3 Apoptosis cAGCTTGCCC AccCATGCTC -328 to
-308
9305847
PIR121 Apoptosis GtACcTGTCCCTCTCAGTGcttCcTGCCa -4061 to
-3941
17245118
PTEN Cell cycle arrest GAGCAAGCCCCAGGCAGCTACACTGGGCATGCTC -1190 to
-1157
11545734
PTGF-beta_FBS01 Growth inhibition cAtCTTGCCC AGACTTGTCT -898 to
-879
10618379
PTGF-beta_SBS01   AGcCATGCCC GGGCAAGaaC -43 to -24 10618379
PUMA Apoptosis ctcCTTGCCTTGGGCTAGgCC -230 11463391
    ctGCAAGTCC tGACTTGTCC -144 11463391
RGC Ribosomes synthesis GGACTTGCCT GGcCTTGCCT NA 2047879
RPS27L Apoptosis GGGCATGTag tGACTTGCCC intron 1 17057733
S100A2 Calcium-binding protein GGGCATGTgT GGGCAcGTTC -3811 10094469
SEMA3F Angiogenesis inhibition GGtCAAGTTCTTGAGCAAAcTCATGCTT intron 1 17308083
    cAGCATGCCaTGAGGGgTAGggT intron 1 17308083
type IV collagenase Angiogenesis AGACAAGCCT GAACTTGTCT -1649 to
-1630
9343394
WAF15’ Cell cycle arrest GAACATGTCC cAACATGTTg -2.3 kb 8242752
WAF1 3’   GAAgAAGaCT GGGCATGTCT -1.4 kb 9679054

(a) Non-functional putative p53-RE are indicated in italic.
(b) Bases that do not correspond to the p53-RE consensus sequence are in lowercase.